Table S1.

GENE NAME CG NUMBER FORWARD PRIMER REVERSE PRIMER
Abi CG9749 CTGTACGTGCTCAAGAAAAACG GCATAGGTTCGGGTAGTATTGG
Abl kinase CG4032 GAGTCTGAGCCAAGTGATAGCC CTTGGGTGAGCTACTGGAACC
AcGAP CG13345?? ATCATCGACATGGAGATCAAGG TGTCTTCTGACTGAAGGTGTGG
adf/cofilin homologue CG6873 GAAACTCTCGCTTGAGCACC ATCTGGAATTAATTTGAGCCGC
Aip1 CG10724 TTCAAGTTCAAGATGACCAAGC TTCACCACATAGTCCGTGTAGG
Alpha-actinin CG4376 GTCATGAAGTCGAGGAAGGC CTAGAGAACCCCTACACCACCC
Anillin CG2092 TAGAAATCTATGGCATGTTGGC GAGAAAACTGTTAACAACCCGC
Basket CG5680 GAGCAGTGGAAGGAGCTAATCTAT AAGAAATTACAAAGTTTCGCATAT
Capping protein CG17158 CTGGTCGAACTCCTACTATCCG CTCAGTACTCAGTTCGATTCGG
Cappucino CG3399 ATATTGGACACGGATAGTGACG CGTAAGGATGATGGAGAAGACC
Capulet CG5061 ACTGCAGTACGTGACGCTGG CACTCAGATCCAGCATGGG
Cdc42 CG12530 CGAGATTACACACCATTGCC ATAGAAACCGACCAAAATACCG
Ciboulot CG4944 GAAGGAGAAGAATCAGTTCATCG TATACGCTTCATACGTTTTGCG
Citron kinase CG10522 GTGAAACCGTTGGTGATATGC TTCAACCTCTGGAAGTTATCGG
Cofilin (twinstar) CG4254 ATGTTGTACTCCAGCTCCTTCG ACAGGATACGTGTTTCCATCG
Coracle CG11949 ATTGAAATTCAGCAGCAAACG TTGTATTTGAATGCAATCGTGG
Coronin CG9446 ATCCGGACATCGTTTACAGC GTAGATCATGTTCGTGTCTGCG
Cortactin CG3637 GCATTTAACCAGATGCAGTCG AAAGGATATCTCGTCGTCATCC
Cyclin-dependent kinase 5 CG8203 TACCTAGGCTAAACTCCAAGGG CGTCGACACTCATTAAATTTGG
Dab (disabled) CG9695 CACCTGCAAATACCACTCAACC GGTCTGCTGATCAAAATTAACC
Dah CG6157 GCATTCGAACAGCTCCTAGC AGCAATCGATCGATGATGG
Dcarmil CG1399 AGTCTGGCAAAGAAAGTGCG ATTTAATTGGTCGGCGTTCC
Diaphanous CG1768 TCGTTCTGCATTGTCTATGAGC ATCTTCTTCTCGTACTCCTCCG
DLAR (Tyr-phosphatase) CG10443 ATCAATGCCAATTACTGTGACG GTAGGTGGGTGTGTAGATTGCG
Drebrin-like CG10083 AAACGAGGACGATTTTATCTGC AACTGTGTTATCCTTCGGTTGC
Drk CG6033 ACCACAAAAACTCCATGAACG CAATGTTTCATTTGTGTATTCGC
DROK CG9774 GAGAACACTCAAAAGCTGAAAAAG ACAGTTCCTTCTGTAGCTGGTTTT
E-cadherin (shotgun) CG3722 ATATTGTGTCATTCGAGCTGGC TAGGCTTCGACAGTGAGTATGC
Enabled CG15112 AATGTACATGGTGGGTCATGG CTTTTTGAGCTTGATCTGCTGC
Fascin CG1536 CACACAGTGGGAGTTCTAGGG GTCTTTCTTCATTTTTGCTGGC
Filamin CG3937 CTATTCCGAGATGCACATACCC CTTGTGTCCAGTCTTCACTTCG
Fimbrin CG8649 GTTGTTGAACAGATTAGCCACG TGTATCTGAGCATCAAGGATGG
Forked CG5424 CGTTGGTAACGCTAATTCTGG ATTTATTGTTTCATTCGTTCGC
Formin/DIA-like CG14622 CTCTATTGTGCGCTTTTTGAGC CCCTAGGTATGATCCACTGTCC
Gelsolin CG1106 TGACTCAGCTAAAGAAGAGCGG CTTCAACCTTCAAAAATCCACC
Genghis Kahn CG4012 TTGGAGTATCTGAAGCATGTGG TTTGTGGGACTACTGAATGTGC
Hemipterous CG4353 AACTCAATGGTGGACATTATATCG ATCAAATTGTGCCAGTGATACC
HSPC300 CG30173 ATGTAACATCATCGGAGGGC TACCTCGCACTCTTTGGCTT
Kelch CG7210 CAGATGTCAAATCCGTATGGC TCGTTCAGATTATTGCTGTTGG
Kette (Nck/SCAR-binding) CG5837 ACCTGGTACAGTGAGGTTCTGC CATCAGTAGACAGGCAGTGAGG
Lethal (2) giant larvae CG2671 TATTAGCTGGCCTATCACTGGC GTCAAAGAGAACTAAGCCGTGC
Lim kinase CG1848 ATATTGGAGATAGGATATTGGAGG TGTGCAGTTTCTTATCCTTGTACAG
Merlin CG14228 GATGGGGTATTAGTCATGTCGG GACCTGGAGAAGAAGATTCGC
Moesin CG10701 AGACGCTTTGTCTCCTCATCC GAAAAGAAGCAGCAGGAGTACG
Mtl (Rac-like) CG5588 GCGAAGTATAGAGATTCCTCGG CTAGGAAATGCATAGATGCTCG
Mushroom bodies tiny CG18582 AGATACTCAAGTCCTCCAACCG ATACATGGGAGGATAGCTGCC
Myoblast city CG10379 CTTCTGGTATTTGAGGAGCTGG GAACAGATGCTTGTATTCAGCG
Myosin IA CG7438 GATTTCCGTATCACCCACTACG CACAATATGTGGGATCATTTCG
Myosin IB CG9155 AAGTCCACCTGGCCCAATTACAAGG AATCAAGTCGCCCTTGTCCTTTTTC
Myosin II (zipper) CG15792 CCTAAAGCCACTGACAAGACG CGGTACAAGTTCGAGTCAAGC
Myosin V CG2146 GCCATTTAAGGTTGTCTTCAGG AACAAATGCCAACGTAGTTTAGG
Myosin VI CG5695 AGGCTTCAAACTTTTACATCGG GTCTTGAACTTAGATCCCACGG
Myosin VII CG7595 TCTAGATAAAAACCGGGACACC GATGTGACAGAACTCTCGAACG
Myosin VII CG6976 AGAACTGGAGTCGCCTAATAGC ATCTTGAAGTTTTTCACTCGGC
Myosin XV CG2174 GGCCAGAGGTACACCCTACC ATTTTCCAAACGAAAACTGACC
Myosin XVIII (PDZ-myosin) CG10218 GGACAGCCATCCTTTTATATCG GTCCATCTCGATTTCTACCAGC
Nck (Dreadlocks) CG3727 GACCAACTGGTCGATCACTACC GAGTGTTCTGATTAAAAGCGGC
Nullo CG14426 AAGCAACATCCAGAGACTCG CGTAGTAATCCTCCAGATCGC
Ovarian tumor CG12743 GAAACTAAACTGACTGCCATTCG TGAATTACGTGCCAATGATACC
p20 of Arp2/3 complex CG5972 CAGACAACAACCCGACACC CAGTTTCATTTCGCTGATCTCC
Pak1 kinase CG10295 ATTGACAACCAAGAAGAAACCG GCGATAATACTCCAAGTCATAGGG
PKN CG2049 AAACTTTGACGAGGAGTTCACG CAGACTATTCAATGCGTTCTCG
POD-1/coronin CG4532 AAATTAATGGAGGAGCATCGC GGTTGTACACCCTAATCTTGCC
Pp2A CG13383 AGAGCTGTTCAAACTAATGGGC CGTACAAAACCCAATGGCG
Profilin (chickaddee) CG9553 CTTCCGTGGTAGAGAAACTTGG TTCTTAACTATTGATTGGGGCG
Quail CG6433 GTACCGAGATGCCTTACAATGG GCATTTTGGACATAACTTTGGG
Rab5 CG3664 GCAGTAACCGTCCGTAGAACC GTCCCAGATCTCGAACTTAACG
Rac1 CG2248 CACAAAACGCGAGTTAAAGAGG CGAGCACTCCAGATACTTGACC
Rho1 CG8416 ATCAAGAACAACCAGAACATCG TTTGTTTTGTGTTTAGTTCGGC
RhoBTB CG5701 TTGAAGAGTGACCTGGTTATGC CTCCGTGTCATCGTTAAAGTCC
RhoL CG9366 GAGATACACGCATTCAACTTGG CATAAGGATTCACACAAGTGGC
Rhophilin CG8497 CTTTTCCGCTACTACAACACGC CAGCTGAAGCTTCTCAAAGAGG
Sanpodo CG1539 ATGGGCCATCTGACCAGG AATAGCAGTAAATTGTTTTCAGAGACC
Scar CG4636 GTGTATCAGCAGGATGAGCTGC TCTTCTGTTTCTTATTGCCACG
Scraps CG2092 TAGAAATCTATGGCATGTTGGC GAGAAAACTGTTAACAACCCGC
Slingshot CG6238 GGAGATCGATAACTTCTTTCCG GTTCTCCATAGACTGGCTTTGC
Spire CG10076 CGGGAATCAGATCAGAGATAGG CAGGAGCAGGGTACAAGTAAGG
Sra-1 CG4931 GATCACGTCAAGTACATTTCGG ATAGCTGAGTGGAGGAAGGTCC
Talin CG6831 ACATGTCTCCACTCAATCATGC AAGCACAATAAACTCGTTCTTGG
Trio (GEF) CG18214 CAGATCGAACTCATCCACACC CAACTGATAGAGGAGCTTCTTGC
Tropomyosin1 CG4898 GACCTCGTCCTGGAGAAGG GATTGCTTTATTGCTTAGTTTGG
Tropomyosin2 CG4843 TGAAGCTTGAGAAGGATAACGC CAGCTCGTCTTCAACGAAGG
Twinfillin CG3172 ATAGGTCCCCTACTGGAAAAGG GTACGACTCAAAGTAGTCGCCC
Vav CG7893 AAAGTTCCTGGACAAACTAAGGG TACAAAGTGAAGGCTGTCTTGC
Villin-like CG1141 ATGCCGACTGTTACTTGAATCC TTCTCCTTGTCCAACTCTACGG
Vinculin CG3299 TGTTTAGCTACCAACAAGACCC ATTAACCTGATTGTGGAGGAGG
WASP CG1520 GTGCAGATCTACAAGACGGAG TTCCGTAGGGGATTCTACACT