Table S2. Primers for HIPK2 mutant mice PCR genotyping (Fig. 5A)

Allele Forward Primer (5'--> 3') Reverse Primer (5' --> 3')
Wild type CCTGTCTCTGTCACCTATCTTGC CCCAGTTGGAACTTGGCTCTAC
Mutant CCTGTCTCTGTCACCTATCTTGC CCACAGATGAAACGCCGAGT
cDNA were amplified for 15 cycles at 94°C for 45 s, 56°C for 45 s and 72°C for 1 min, preceded by a cycle at 94°C for 5 min.