Table S3. Primers for RT-PCR to detect HIPK2 cDNA (Fig. 5 E)

Exon Forward Primer (5’ --> 3’) Reverse Primer (5’--> 3’)
3 CCAAGCCTACCTTACGACA AGGTGTCAAGGAGGCTCCA
15-16 CTTCAGGAGCCATCGCCTAC CTGTTGTGCGGGAAGGTGTA
cDNA were amplified for 29 cycles at 94°C for 30 s, 58°C for 30 s and 72°C for 45 s, preceded by a cycle at 94°C for 5 min.