Table S1. Oligonucleotide Primers Used in This Study.

Primer

Sequence (5' to 3')

Purpose

1

ATAGGATCCACAATAAACAATTTTACCTTC

PCR of a 4-kb DNA fragment containing the ospAB genes

2

ATAGGTACCAAATGTTTACAGTAGTTTAGC

PCR of a 4-kb DNA fragment containing the ospAB genes

3

CATTCTAGACATTTAACTTTTCTTTTTCCTGAAA

PCR of a 2-kb DNA fragment containing the ospAB genes for complementation

4

CTTGAGCTCCTAAGAGACTTTTTCCAGAAGTAACA

PCR of a 2-kb DNA fragment containing the ospAB genes for complementation

5

GCCGATGGTGATCACCTG

RT-PCR of I. scapularis ß-actin mRNA

6

GATGACCCAGATCATGTTCG

RT-PCR of I. scapularis ß-actin transcript

7

AGAATTACTTCAAAGGCT

RT-PCR of flaB mRNA

8

TGTAGTTGTAACATTAAC

RT-PCR of flaB mRNA

9

GCTCCTTCCTGTTGAACACCC

Real-time PCR of the flaB gene, forward primer

10

CTTTTCTCTGGTGAGGGAGCTC

Real-time PCR of the flaB gene, reverse primer

11

6FAM-CTTGAACCGGTGCAGCCTGAGCA-TAMRA

Real-time PCR of the flaB gene, probe primer

A

TGTAAGCAAAATGTTAGCAGCCTT

PCR in Fig. 1

B

CAGCAGTTAGAGTTCCTTCAAG

PCR in Fig. 1

C

CTACCGAGCTTCAAGGAAGA

PCR in Fig. 1