Table S1. Sequences of oligonucleotide primers used in this project

 

All primers expressed as 5'­3'

1, Vα1 -TCR cloning

GGAATTCGCTTGAAGTGTGAATCTTC

2, Cα-TCR cloning

GAGCCCGGGTCAACTGGACCACAGCCTCAG

3, Vß 8.2 - TCR cloning

GGAATTCCAAGATGGGCTCCAGGCTCTT

4, Cß -TCR cloning

GAGCCCGGGCGAGGAAGGATGGATATCCATG

5, Vα1 -TCR sequencing

ACCTCAATAGAGCCAGCCTGATG

6, Cα -TCR sequencing

CCATTGCTCTTGGAATCCATAGC

7, Vß8.2 -TCR sequencing

CATATGGTGCTGGCAGCACTGAGA

8, Cß -TCR sequencing

TAGCTATAATTGCTCTCCTTGTAG

9, Vκ -genotyping

CAGTGATTCTTGTTGACTG

10 , Jκ 1-genotyping

GACATAGGATCCGGAAGAAAGAGACTTTGGAT

11, sense I-Akß1

TACGGAATTCTTAGAGATGGCTCTGC

12, antisense with FR-12

cgatgggatctgcgtcatctggatgtcGCCCTCAGTCCCGGG

13, antisense no.2 with FR-13

GGGCACTAGTGAACCTCCTCCtgccgacaacgaCGATGGGATCTGCGT

14, acidic zipper -sense4

GCTAGCCTTGTACTAGGAGGCTCTGGAGGTGGGGCC

15, acidic zipper -antisense5

GCATGCTCAGTCCCGCAGCTC

16, I-Akα-antisense6

CACAGATCCTCGAGAGGATGCCG

17, basic zipper -sense7

GGTACCTTAATGGTGATGGTGATGGTGCTGGGCCAGTTTCTTTTT

18, basic zipper -antisense8

CACTGGGAACCTGAGCCATGGGCATCTCTGGTTCTTGGGGGATCAGG

1Bold, EcoRI.2Lowercase, start of FR-1 peptide; underlined, I-Akß overlap.3Bold, SpeI; lowercase, end of FR-1 peptide; underlined, primer no.12 overlap.4Bold, NheI.5Bold, SphI; underlined, BirA sequence overlap.6Bold, XhoI.7Bold, KpnI.8Bold, NcoI; underlined, I-Akα overlap.